Sequence File Formats in Bioinformatics: GenBank, FASTA, PIR and ALN/ClustalW2

Sequence File Formats: GenBank, FASTA, PIR and ALN/ClustalW2

Sequence file formats are standard ways of storing biological sequence information in a computer-readable form. In bioinformatics, DNA, RNA and protein sequences are frequently transferred between databases, software programs and researchers. For this reason, sequences are stored in specific formats such as GenBank, FASTA, PIR and ALN/ClustalW2.

These formats may look similar at first, but their purpose is different. Some formats contain detailed biological information along with the sequence, while others mainly store the sequence itself. Some are designed for a single sequence, whereas others are commonly used for multiple sequence alignment.

This topic is important for students of CSIR NET, GATE Biotechnology, DBT BET, ICAR JRF, ICMR JRF, CUET PG, MSc Biotechnology and Bioinformatics because questions are often asked about the structure, use and differences between these formats.

Table of Contents

1. What is a Sequence File Format?
2. Why are Sequence File Formats Important?
3. GenBank Format
4. FASTA Format
5. PIR Format
6. ALN / ClustalW2 Format
7. GenBank vs FASTA vs PIR vs ALN
8. Simple Examples of Each Format
9. How These Formats Are Used in Bioinformatics
10. Sequence Format Conversion
11. Important Points for Competitive Exams
12. MCQs
13. Frequently Asked Questions
14. Conclusion

1. What is a Sequence File Format?

A sequence file format is a defined structure used to save a biological sequence and, depending on the format, information related to that sequence.

For example, suppose we have a DNA sequence:

ATGCGTACCGTAGCTAGCTAG

A computer can store this sequence simply as letters. However, researchers usually need additional information such as the sequence name, accession number, organism, gene name, features, annotations, alignment positions or other information.

Different file formats solve different requirements.

• FASTA: mainly stores sequence identification information and the sequence.
• GenBank: stores the sequence together with extensive annotation and biological features.
• PIR: is an older sequence format associated with the Protein Information Resource and can contain sequence identification information and protein sequences.
• ALN/Clustal: is commonly used to store the result of a multiple sequence alignment.

The choice of format depends on what we want to do with the sequence.

For example, if we only need the sequence for a BLAST search, FASTA is often convenient. If we need detailed annotation such as coding regions, genes, CDS, references and other features, a GenBank record is much more informative. If sequences have already been aligned, an ALN file can preserve the alignment.

↑ Back to Index

2. Why are Sequence File Formats Important?

Bioinformatics involves moving sequence data between many databases and software programs. Without standard formats, every program would require a different way of reading sequence information.

Standard file formats make it easier to:

• store DNA, RNA and protein sequences;
• exchange sequence data between researchers;
• submit sequences to biological databases;
• perform sequence similarity searches;
• perform multiple sequence alignment;
• predict genes and proteins;
• study mutations and sequence variation;
• construct phylogenetic trees;
• annotate genes and proteins;
• move data between bioinformatics software.

Easy way to remember:

FASTA → sequence

GenBank → sequence + detailed annotation

PIR → protein sequence information

ALN → alignment

↑ Back to Index

3. GenBank Format

GenBank is one of the most widely recognized formats for representing nucleotide sequence records. A GenBank record contains not only the DNA or RNA sequence but also detailed descriptive and annotation information.

GenBank records are particularly useful when we want to know the biological context of a sequence. The record may contain information such as the organism, accession number, references and annotated features.

3.1 Main Features of GenBank Format

A typical GenBank record contains several sections. Common sections include:

• LOCUS – basic information about the sequence record.
• DEFINITION – description of the sequence.
• ACCESSION – accession number assigned to the record.
• VERSION – version information.
• SOURCE – biological source or organism information.
• FEATURES – important annotated biological features.
• ORIGIN – actual nucleotide sequence.

3.2 Example of a GenBank Record

LOCUS Example_DNA 30 bp DNA DEFINITION Example nucleotide sequence. ACCESSION ABC123456 VERSION ABC123456.1 SOURCE Example organism FEATURES Location/Qualifiers gene 1..30 CDS 1..30 ORIGIN 1 atgcgtaccg tagctagcta gctagctagc //

The above example is simplified. Real GenBank records can be much longer and contain many more fields.

3.3 What is the FEATURES Section?

The FEATURES section is one of the most important parts of a GenBank record. It describes biologically meaningful regions of the sequence.

Features may include:

• gene
• CDS (coding sequence)
• mRNA
• exon
• intron
• promoter
• rRNA
• tRNA
• regulatory regions

This makes GenBank much more informative than a simple sequence-only format.

3.4 Advantages of GenBank

• Contains detailed sequence annotation.
• Provides accession and version information.
• Useful for understanding biological features.
• Widely used in sequence databases and bioinformatics.
• Useful when sequence and annotation are needed together.

3.5 Limitation

GenBank records contain much more information than a simple FASTA file. Therefore, if we only want the raw sequence for a quick analysis, GenBank may be unnecessarily detailed.

3.6 Important Website

NCBI provides access to GenBank and other sequence resources:

NCBI GenBank – Official Website

NCBI Nucleotide Database

↑ Back to Index

4. FASTA Format

FASTA is one of the simplest and most commonly used sequence file formats in bioinformatics. It can be used for DNA, RNA or protein sequences.

The most important feature of FASTA is its simple structure. A FASTA sequence normally begins with a line starting with the > symbol. This is called the description or header line. The sequence is written on the following line or lines.

4.1 Basic Structure of FASTA

>Sequence_ID Description ATGCGTACCGTAGCTAGCTAGCTAGCTA

The first line is the header, while the lines after the header contain the sequence.

4.2 DNA FASTA Example

>Human_example_gene ATGCGTACCGTAGCTAGCTAGCTAGCTAACG

4.3 Protein FASTA Example

>Example_protein MKTLLILAVCLVFAQAEPGKTK AAGVEAGDNVGLLLR

Protein sequences in FASTA use the one-letter amino acid code. Unlike DNA, protein FASTA sequences contain amino acid letters such as M, K, L, A, G, V and others.

4.4 Multiple Sequences in FASTA

FASTA can also contain multiple sequences in the same file. Each sequence starts with its own > header.

>Sequence_1 ATGCGTACCGTA >Sequence_2 ATGCGTTCGATA >Sequence_3 ATGAGTACCGTA

This type of file is often used as input for sequence alignment programs, BLAST searches and many other bioinformatics tools.

4.5 Advantages of FASTA

• Very simple format.
• Easy for humans to read.
• Easy for software to parse.
• Can store nucleotide or protein sequences.
• Can contain one or many sequences.
• Supported by a large number of bioinformatics tools.

4.6 FASTA in BLAST

FASTA is especially common when preparing sequences for BLAST searches. A query sequence can be provided in FASTA format and compared against sequences in a database.

NCBI BLAST:

NCBI BLAST – Official Website

4.7 Important Point

Exam point: The > symbol at the beginning of the first line is a key characteristic of the FASTA format.

↑ Back to Index

5. PIR Format

PIR refers to a sequence format historically associated with the Protein Information Resource (PIR). It is mainly encountered in protein sequence analysis and in software that supports PIR-style sequence files.

PIR format is different from FASTA because it has a more structured header system. A PIR sequence generally begins with a line containing a special two-character code followed by an identifier or name. The next line contains a description, followed by the sequence.

5.1 Basic PIR Structure

>P1;EXAMPLE Example protein sequence MKTLLILAVCLVFAQAEPGKTK*

Here:

• >P1; indicates a PIR protein sequence entry in this style.
• EXAMPLE is the sequence identifier.
• The next line provides a description.
• The following lines contain the protein sequence.
• The * character is used in PIR-style protein sequence representations to indicate the end of the sequence.

5.2 PIR Codes

PIR formats can use different two-character codes depending on the type of sequence or entry. The exact codes depend on the particular PIR specification or software implementation.

For students, the most important association is:

PIR → Protein Information Resource → Protein sequence format

5.3 PIR vs FASTA

FASTA and PIR can both store protein sequences, but their header structures are different.

Feature	FASTA	PIR
Typical beginning	>Sequence_ID	>P1;Sequence_ID
Description	Usually part of the header	Traditionally given on a separate line
Sequence type	DNA, RNA or protein	Commonly associated with protein sequences
End marker	Usually no special end character required	PIR-style sequence commonly uses *

5.4 Where PIR Format Can Be Seen

PIR-style files may be encountered in protein sequence analysis and in some molecular modelling or structure-related software workflows.

For students preparing for examinations, it is useful to remember the historical connection between PIR and protein sequence resources.

Protein Information Resource (PIR)

↑ Back to Index

6. ALN / ClustalW2 Format

ALN is commonly used as the file extension for a Clustal multiple sequence alignment. The format is strongly associated with the Clustal family of alignment programs, including ClustalW and Clustal Omega.

Unlike FASTA or a basic GenBank sequence record, an ALN file is mainly concerned with showing how two or more sequences have been aligned.

6.1 What is Multiple Sequence Alignment?

Multiple sequence alignment, or MSA, means arranging three or more biological sequences so that similar or evolutionarily related positions can be compared.

Gaps are introduced using the - symbol when necessary.

6.2 Example of Clustal Alignment

CLUSTAL W (1.82) multiple sequence alignment Seq1 ATGCGTACCGTAGCTAGC Seq2 ATGCGT-CCGTAGCTAGC Seq3 ATGAGTACCGTAG-TAGC *** ** ******** **

The actual output may contain blocks of aligned sequences. The symbols below the sequences provide information about conservation and similarity.

6.3 Important Symbols in Clustal Alignment

Depending on the Clustal output and version, conservation can be represented using symbols such as:

• * – positions containing identical residues in the displayed sequences.
• : – conserved substitutions with strongly similar properties.
• . – substitutions with weaker similarity.
• - – gap introduced into a sequence.

6.4 What is ClustalW?

ClustalW is a multiple sequence alignment program. It was widely used for aligning DNA, RNA and protein sequences.

The alignment generated by ClustalW can be saved in several formats, with the Clustal alignment format commonly represented using the .aln file extension.

6.5 ClustalW2

ClustalW2 was an updated version of the ClustalW alignment software. It was widely used for multiple sequence alignment before newer tools such as Clustal Omega became common.

Today, the name Clustal may refer to several generations of alignment software. Therefore, students should distinguish between the alignment format and the particular software version.

Clustal Omega is available through EMBL-EBI:

EMBL-EBI Clustal Omega

6.6 Uses of ALN Files

• Storing multiple sequence alignments.
• Comparing homologous genes or proteins.
• Identifying conserved regions.
• Studying substitutions and gaps.
• Finding potentially important residues.
• Preparing alignments for phylogenetic analysis.
• Studying evolutionary relationships.

↑ Back to Index

7. GenBank vs FASTA vs PIR vs ALN/Clustal

Feature	GenBank	FASTA	PIR	ALN/Clustal
Main purpose	Sequence + annotation	Sequence storage	Protein sequence representation	Multiple sequence alignment
DNA sequence	Yes	Yes	Not the main use	Yes
Protein sequence	Protein records also exist in related database formats	Yes	Yes	Yes
Detailed annotation	Yes	Very limited	Limited/structured identification information	No biological annotation by default
Multiple sequences	Records are usually individual database records	Yes	Possible depending on application	Yes
Alignment	No	No	No	Yes
Common extension	.gb / .gbk	.fa / .fasta / .faa / .fna	.pir	.aln
Easy to remember	Rich record	Simple sequence	Protein sequence format	Alignment

↑ Back to Index

8. Simple Examples of Each Format

GenBank

LOCUS TEST_DNA 20 bp DEFINITION Example DNA. ACCESSION ABC000001 FEATURES Location/Qualifiers gene 1..20 ORIGIN 1 atgcgtaccg tagctagcta //

FASTA

>TEST_DNA ATGCGTACCGTAGCTAGCTA

PIR

>P1;TEST_PROTEIN Example protein sequence MKTLLILAVCLVFAQAEP*

ALN / Clustal

CLUSTAL W alignment Seq1 ATGCGTACCGTA Seq2 ATGCGT-CCGTA Seq3 ATGAGTACCGTA *** ** *****

Quick identification trick:

• Starts with > and simple sequence → FASTA.
• Contains LOCUS, FEATURES, ORIGIN → GenBank.
• Contains >P1; style identifier → PIR-style format.
• Contains CLUSTAL and aligned sequences → ALN/Clustal.

↑ Back to Index

9. How These Formats Are Used in Bioinformatics

In a typical bioinformatics workflow, the same biological sequence may appear in several different formats depending on the analysis being performed.

For example, a researcher may download a nucleotide record from NCBI in GenBank format. The sequence can then be extracted and saved as FASTA. Several FASTA sequences can be aligned using Clustal. The resulting alignment can be saved as an ALN file.

This shows why understanding file formats is not just a theoretical topic. It is part of normal bioinformatics work.

↑ Back to Index

10. Sequence Format Conversion

Sometimes a bioinformatics program accepts only a particular file format. For example, a tool may require FASTA input even though the sequence is currently available as a GenBank record.

In such cases, the sequence can be converted from one format to another.

Popular tools and software libraries used for sequence format handling include:

• NCBI resources
• EMBL-EBI tools
• EMBOSS
• Biopython
• Sequence analysis software such as MEGA and other alignment programs

One important software library is Biopython, which provides tools for reading and writing many biological sequence formats.

Biopython – Official Website

EMBL-EBI Tools

Example of a Conversion Concept

GenBank ↓ Extract sequence ↓ FASTA ↓ Multiple sequence alignment ↓ ALN / Clustal format

The important point is that conversion should preserve the information needed for the next analysis. When converting from a richly annotated format to a simple sequence format, some annotation may not be carried into the new file.

↑ Back to Index

11. Important Points for CSIR NET, GATE, DBT BET and JRF Exams

GenBank

• GenBank is a nucleotide sequence database/resource associated with NCBI.
• GenBank records contain sequence information and annotation.
• LOCUS, FEATURES and ORIGIN are important terms.
• FEATURES contains biologically relevant annotations.
• Accession numbers are used to identify database records.

FASTA

• FASTA is a simple sequence format.
• The header normally begins with >.
• Can store DNA, RNA and protein sequences.
• Can contain multiple sequences.
• Frequently used as input for BLAST and alignment tools.

PIR

• PIR is associated with the Protein Information Resource.
• PIR-style format is commonly encountered with protein sequences.
• >P1; is an important format identifier.
• An asterisk may mark the end of a PIR-style protein sequence.

ALN / Clustal

• ALN commonly represents Clustal alignment output.
• Used for multiple sequence alignment.
• ClustalW is a multiple sequence alignment program.
• ClustalW2 was an updated version of ClustalW.
• * commonly indicates an identical position in a Clustal alignment.
• - represents a gap in an alignment.

Most Important One-Line Facts

Question	Answer
Which format contains detailed annotation?	GenBank
Which format is very simple and widely used for sequence data?	FASTA
Which format is associated with Protein Information Resource?	PIR
Which format stores multiple sequence alignments?	ALN/Clustal
Which symbol starts a FASTA header?	>
Which GenBank section contains biological features?	FEATURES
Which GenBank section contains the nucleotide sequence?	ORIGIN
Which symbol represents a gap in alignment?	-

↑ Back to Index

12. MCQs on Sequence File Formats

Q1. Which sequence format commonly starts with the > symbol?

A. GenBank
B. FASTA
C. ALN
D. PDB

Answer: B. FASTA

Q2. Which format contains a FEATURES section?

A. FASTA
B. GenBank
C. ALN
D. PIR

Answer: B. GenBank

Q3. Which format is mainly used for multiple sequence alignment?

A. ALN
B. FASTA
C. GenBank
D. TXT

Answer: A. ALN

Q4. PIR is associated with:

A. Protein Information Resource
B. Protein Imaging Resource
C. Plant Information Repository
D. Protein Interaction Record

Answer: A. Protein Information Resource

Q5. Which section of a GenBank record contains the actual nucleotide sequence?

A. LOCUS
B. FEATURES
C. ORIGIN
D. ACCESSION

Answer: C. ORIGIN

Q6. Which symbol is generally used to represent a gap in sequence alignment?

A. *
B. #
C. -
D. >

Answer: C. -

Q7. Which format is most convenient when only a nucleotide or protein sequence is needed?

A. FASTA
B. GenBank
C. ALN
D. GFF

Answer: A. FASTA

Q8. ClustalW is primarily used for:

A. Genome assembly
B. Multiple sequence alignment
C. Protein purification
D. DNA extraction

Answer: B. Multiple sequence alignment

Q9. Which format is most information-rich among the formats discussed here?

A. FASTA
B. GenBank
C. ALN
D. Simple TXT

Answer: B. GenBank

Q10. A file containing several sequences aligned in blocks with conservation symbols is most likely:

A. FASTA
B. GenBank
C. ALN/Clustal
D. PIR

Answer: C. ALN/Clustal

↑ Back to Index

13. Frequently Asked Questions

1. What is the simplest sequence file format?

FASTA is one of the simplest and most widely used formats for storing DNA, RNA or protein sequences.

2. What is the main difference between GenBank and FASTA?

FASTA mainly stores the sequence with a header, while GenBank contains the sequence along with detailed annotation and biological features.

3. Can FASTA store protein sequences?

Yes. FASTA can store nucleotide as well as protein sequences.

4. What does the > symbol mean in FASTA?

It marks the beginning of the FASTA header or description line.

5. What does ALN stand for?

ALN is commonly used as the file extension for an alignment produced in Clustal format.

6. What is ClustalW used for?

ClustalW is used for multiple sequence alignment of DNA, RNA or protein sequences.

7. What is PIR format?

PIR is a sequence format associated with the Protein Information Resource and is commonly encountered in protein sequence analysis.

8. What is the FEATURES section in GenBank?

It contains annotations describing biologically important regions such as genes, CDS, exons and other features.

9. Which format should I use for BLAST?

FASTA is commonly used to provide a query sequence to BLAST.

10. Which format is used to save multiple sequence alignment?

ALN/Clustal is a common format for storing multiple sequence alignments generated by Clustal programs.

↑ Back to Index

14. Conclusion

Sequence file formats are a basic but very important part of bioinformatics. A researcher may work with the same biological sequence in different formats during different stages of an analysis.

GenBank is useful when we need a sequence together with detailed biological annotation. FASTA is preferred when a simple DNA, RNA or protein sequence is required. PIR is a protein-oriented sequence format associated with the Protein Information Resource. ALN/Clustal is used to represent multiple sequence alignments.

The easiest way to remember the four formats is:

GenBank = Sequence + Annotation

FASTA = Simple Sequence

PIR = Protein Sequence Format

ALN = Alignment

For competitive examinations, remember the characteristic terms: LOCUS–FEATURES–ORIGIN for GenBank, > for FASTA, >P1; for PIR-style protein entries, and CLUSTAL/aligned sequences for ALN.

Once these formats are understood, many other bioinformatics topics such as BLAST, sequence alignment, phylogenetic analysis, genome annotation and sequence database searching become easier to understand.

Study Tip: Don't try to memorize the complete syntax of every format. First identify what information the format is designed to store. Then remember one or two characteristic features of each format.

↑ Back to Index